<<

. 31
( 45 .)



>>

28 Tolmre, J L , Davidson, H R , May, H M., McIntosh, K , Paterson, J S , and
Smith, B (1995) The pre-natal excluston test for Huntmgton™s disease expert-
ence m the west of Scotland, 1986-1993 J Med Genet 32,97-101
29 Martmdale, B and Bottomley, V (1980) The management of famtltes with
Huntington™s chorea a case study to illustrate some recommendations J Chzld
Psycho1 Psychzat 21,343-351
30 Walker, D. A , Harper, P S., Wells, C E , Tyler, A , Davies, K , and Newcombe,
R. G. (198 1) Huntmgton™s chorea m South Wales A genetic and eptdemtologtcal
study Clan Genet 19, 213-22 1
31. Harper, P S , Tyler, A , Smith, S., Jones, P., Newcombe, R G , and McBroom, V
(1982) A genetic regtster for Huntmgton™s chorea m South Wales. J A4ed Genet
19,24 l-245
12
Genotyping and Susceptibility of Sheep to Scrapie
Nora Hunter

1. Introduction
Scrapie, as a disease of sheep and goats, has been recognized for over 300 yr
and was first documented m England in 1730 (1). Sheep breeders petitioned
the House of Commons of Kmg George II in 1754 requesting the enforcing of
regulations governing the sale and distribution of sheep This is believed to
have been prompted by a maJor scrapie epizootic However, the petition was
referred to “the consideranon of a Commntee” and vanished without a trace
(2)--not so different from the present day!
Despite the disease being made notifiable m the European Community m
January 1993, the true incidence of scrapie m Great Britain ts unknown, partly
becauseof the stigma attachedto it. Prior to notification legislation, however, ques-
tionnaire surveys were carried out in the hope of estabhshmg the frequency of
scrapie cases.One report on two self-administered surveys suggested that one-
third of British sheepflocks are infected with scrapie, with mean incidence figures
of 0.5 and 1.1 scrapie cases/l00 sheep/yr (3). A second report of a postal survey of
farmers who had requested Veterinary Investigation Centre (WC) diagnosis to
confirm scrapie m then sheep found median incidence rates ranging from 0.49-
1.02 cases/l00 sheep/yr but also discussedsourcesof bias in such studies (4). The
cost of WC dtagnosis may have meant that the farmers or the sheep were not
typical. The animal may have been a recent expensive purchase and indeed, the
proportton of rams among the WC casesm the second survey was very much
higher than that found in the general sheep population. The secrecy surroundmg
scrapie in Great Britain may lead, m random surveys, to misleading conclusions.
1.1. Clinical Signs
Chmcal signs of natural scrapie m an outbreak currently occurring m the
flock of Cheviots at the Neuropathogenesis Unit (NPU Cheviots, described in
From Methods /n Molecular Medune R/on Dseases
Edlted by H Baker and R M Rldley Humana Press Inc , Totowa, NJ


211
Hunter
212

Table 1
Incubation Periods in NPU Cheviot Sheep
Following Subcutaneous Injection with SSBP/l Scrapie
Sip genotype sAsA sApA PAPA
PrP genotype VaINal, 36 VaIlAla, 36 Ala/Ala13,
Mean incubation pertod, d 167 315 Survrve


the followmg) can last up to 3 or 4 mo, whereas followmg experimental chal-
lenge of the sheep, the course IS much shorter-2-3 wk, and sometimes less.
Wtth natural scrapte, NPU Chevtots mvartably show signs of a progressive
prurttus, with hyperesthesia and mcoordinatton of gait Htstopathology shows
some variation m mtensity of vacuolatlon of neuroanatomxal regions but the
bramstem 1s most frequently affected, e.g., dorsal vagus and thalamtc nuclei. If
vacuolatton of the cerebellum occurs, it IS a focal lesion and cortrcal vacuolatton
IS not common With expertmentally induced disease in the NPU flock, ataxra
always 1spresent but prurttus 1s hardly ever seen. The drstrtbutton of vacuolatton
sometimes can vary depending on route of challenge and source of moculum
However, following subcutaneous mjectton of the SSBP/l source of scrapte,
vacuolation of the drencephalon either IS very mild or absent altogether (5)
Detection of the abnormal disease-related form of the PrP protein (PrPsc)
etther confirms the histopathology or is used alone to diagnose scrapie post-
mortem. Scrapte-associated fibrtl (SAF) detection and extraction of PrP pro-
tem from brain tissues, followed by immunoblottmg to reveal the partial
protemase resistance that 1s a charactertstrc of PrPSC are techniques covered m
other chapters m this volume.
1.2. Sheep PrP Gene Variants and Association with Scrapie
In 1960, a flock of Cheviot sheep (NPU Cheviots) was founded and then
selected mto two lines based on suscepttblltty to scrapie challenge. Response
to SSBP/I scrapie (an A group scrapre isolate) in these sheep was controlled by
a single gene, Sip (Scrapte lncubatton Period) with two alleles, sA and pA (6),
standing for “short with A group scrapie” and “prolonged with A group
scrapie,” respectively. Positive line sheep, susceptible to subcutaneous (SC)
mjectton wtth SSBP/l are SzpSAsAor SzpSApA, with the sA allele bemg domt-
nant. Negative lme sheep are SippApA and resist SCinjection with SSBP/l. PrP
codon 136 variants are tightly lurked to Szp m that SzpSASAanimals encode
valme (Val or V) and SzppApAencode alanme (Ala or A) on both PrP alleles (8).
Heterozygous Szp sApAsheep therefore are Val/AlaIJ6 (Table 1). Szp genotype
groups m the NPU Cheviot flock now are divided mto subgroups based on
their encoding PrP variant genes and on mcubatlon period groups (5). Variants
Sheep PrP Gene and Scrapie 213
Table 2
Sheep PrP Gene Variants
Sheep PrP gene codon polymorphrsms
Codon Amino actd change Breed Ref
112 Methtonme (Met)
Threonme (Thr) Ile de France 8
136 Alanme (Ala)
Valme (Val) 7
Many
141 Leucine (Leu)
Phenylalanine (Phe) NPU Chevlots 5
154 Htstidme (His)
Arginme (Arg) Many 7
171 Glutamme (Gin)
Argmme (Arg) Many 5, 9, 10
Hrstrdme (HIS) Texel
Awassi
Sheep protein variants
Codon 112 136 141 154 171
Met Ala Leu Gln
Arg
Met Val Leu Gln
Arg
Met Ala Leu HIS Gin
Met Ala Leu A% A rg
Met Ala Leu HIS
A%
Met Ala Phe Gln
A rg
Ala Gln
Thr Leu A%


at other codons are not linked to Sip but form subgroupings of the Alalj6
encoding PrP allele. Polymorphrc codons frequently are discovered and those
currently known are shown m Table 2 ($7˜IO). The codon variants discussed
m thts chapter are at codons 136 (Val and Ala), at codon 154: arginme (Arg or
R) and histtdine (His or H) and at codon 171 arginine, glutamine (Gln or Q),
and histrdine.
The ranking of mcubatton per-rods with respect to Sip genotype seen with
SSBP/l (Table 1) is reversed partially with the C group scrapte source CH 164 1
that by mteracerebral (rc) challenge gives shorter incubation periods m nega-
tive line animals than in positrve line. There were also some survivors of ic
CHl641 challenge in both lines, which was not fully understood untrl PrP
genetics entu-ely explained the results by the association of incubation period
wrth variation at codon 17 1 (1 I). Both posrtrve and negative line animals that
214 Hunter

Table 3
Incubation Periods in NPU Cheviot Sheep
Following lntracerebral Injection with BSE
Sip genotype sApA sApA
PAP* PAP*
PrP genotype Ala/Ala,,b VallAla,,, VallAla,,, Ala/Ala,,,
Gln/Gln,,, Gln/Gln,,, Arg/Gln,,, Arg/Gln,,,
Mean incubation 680 800 Survive Survive
period, d >1800 >1800


are Gln/Gln,,] succumb to injection with CHl641, whereas Arg/Gln17, and
Arg/Arg,,, sheep have very much longer survival times, with some ammals
apparently resistant. This also is true with BSE when transmitted to these sheep
(Table 3) The genotype at codon 136, so important with SSBP/l , IS of minor
relevance with BSE transmission m that Val,,, is associated with a prolonga-
tion of mcubation period (Table 3), thus explaining the longer mcubation peri-
ods m the positive lme animals that do succumb to experimental challenge
Codon 136 and 171 variants also have association with incidence of natural
scrapie. Most animals with scrapte encode ValiJ6 on at least one allele and are
also Gln/Gln ,,, (unpubhshed observations).
Codon 154 is also associated with scrapie incidence. In NPU Cheviots, some
posttive lme ammals are affected by the natural disease All Val/Val,36 am-
mals die at 700-900 d of age if allowed to live that long. A proportion of het-
erozygous animals succumb to natural scrapie at over 1100 d of age (those that
are Val/Ala,,6:Gln/Gln,7,) but Val/Ala136. Arg/Gln,,, animals survive. Some
Val/Ala136:Gln/Gln,7, sheep do survive, but this depends on the genotype at
codon 154 m that Hts/Argls4 animals survive, but Arg/Argis4 sheep develop
scrapie. It seems that Val,,, is necessary and suffictent for the development of
natural scrapie in the homozygous genotype. Va1,s6 heterozygotes also suc-
cumb tf homozygous at codons 154 and 171, but apparently are resistant if
heterozygous at either codon 154 or 171. It is uncertain what this means m
terms of disease ettology, but it is remmiscent of the human PrP genettcs work,
which has suggested that heterozygosity gives some protection against the
development of Creutzfeldt-Jakob disease (CJD) (22).

2. Methods of Genotyping Sheep
2.1. DNA Extraction
DNA can be extracted from any available tissue sample using methods
detailed m ref. 14. Usually it is most convement to use blood because it does
not have to be homogenized prior to extraction. (Blood samples should be col-
lected in an anttcoagulent, such as EDTA, but not heparm, because it inhibits
215
Sheep PrP Gene and Scrapie




Fig. 1. Genotyping at codon 136 by BspHI digestion of sheep PrP gene PCR prod-
ucts. Tracks (1) marker; (2) Val/Ala,36:Arg/Arg,54; (3) Ala/Ala,36:His/His,S4; (4) Val/
Val,,,:Arg/Arg,,,; (5, 7, 8) Ala/Ala,,,: His/ArglS4; (6, 9) Ala/Ala,,,:Arg/Arg,,,.


some of the enzymes used in genotyping analysis.) However, any other tissue
(brain, liver, spleen, and so on), if removed immediately after death and used
immediately or quickly frozen first, also is satisfactory. Large-scale DNA
preparations are more reliable than those from commercial kits but are not
always necessary.

2.2. Detection of Variants at Codons 136 and 154
Detection of the sequence differences that give rise to the codon variations
is generally carried out on the product (amplimer) of polymerase chain reac-
tion (PCR) amplification of the PrP gene. The amplimer can be analyzed in a
number of different ways, for example, digestion with restriction enzymes,
allele-specific oligonucleotide hybridization, direct sequencing, cloning and
sequencing, or analysis on denaturing gradient gels. The polymorphisms at
codons 136 and 154 both can be detected by digestion with the restriction
enzyme BspHI (New England Biolabs, Beverly, MA) or its isoschisomers,
since at both sites, one allele encodes the enzyme recognition sequence,
whereas the other allele does not. One method for this analysis is detailed herein
and a set of typical sheep genotype results are shown in Fig. 1.
Using the nucleotide numbering system in which the first base of the initiating
methionine is numbered 1, two PCR primers were used as follows: oligo 3 14
(GGTGAAAAGCCACATAGGCAGTTGG) nucleotides 4-28 and oligo 3 15
(CTCACAGATGGACGTCGGGACATCA), which is complementary to
nucleotides 826-850. Using any standard PCR method (23) the amplimer gen-
erated by PCR therefore will be 846 bp.
When using BspHI, it is sometimes necessary to purify the PCR product
before digestion, although this is not always the case with every enzyme. This
can be done by electrophoresing half of the PCR product (25 uL of a 50 pL
reaction) on a 1% Tris-borate agarose gel (Ill) and collecting the amplimer on
DEAE membrane (Schleicher and Schuell, Dassel, Germany) inserted into a
cut in the gel just “in front” of the DNA fragment, eluting in 1.5MNaC1, 10 mM
216 Hunter

Tris-HCl, 1 mA4 EDTA, pH 8.0 and ethanol precipitating prior to digestion
with BspHl followmg the mstructions of the manufacturer. At codon 136, the
Val allele sequence IS =ATGA, which includes the BspHI recogmtion site
(TCATGA, cut after the first T leaving a four-base smgle-stranded overhang
on each fragment). The Alar3, sequence 1s SATGA, which destroys the
enzyme site. Successful restriction is likely to mean that the VallJ6 allele 1s
present. However, a failed restriction Just means the site is no longer encoded,
which could be the result of a mutation m any one of the six bases that form the
restriction site. Because these alleles have been fully sequenced many times,
the assumption is usually made that faded restriction means the genotype is
Alalj6, but it may not be the case. Because of this, the genotypes are sometimes
represented with VaINal, s6 as (+ +), Val/Ala,s, as (+-), and Ala/Ala,3h as (--)
At codon 154, the His allele has the sequence TCAYJGA and is fully digested
with BspHI, whereas the Arg1s4 allele (TmGA) is not. The genotypes are
described as (+) for HisrS4 and (-) for Arg154 m a similar manner to codon 136
However, the codon identity is usually assumed.
Restriction with B.spHI at Val,,, gives rise to a fragments of 403 and 443 bp
and at HisIs generates fragments of457 and 389 bp The Va1,36 allele 1s linked
to Arg,,, and so the doubly digested amplimer is not seen. Followmg diges-
tion, the DNAs are electrophoresed through a 1.8% Tris-borate agarose gel
resulting m sharper ethtdmm-stained fragments than m a Tris-acetate gel (14)
that might be used as an alternative. Examples of typical digestion products are
given m Fig. 1. The use of drfferent PCR priming olrgonucleotrdes will result m
differently sized amphmers and thus differently sized restriction digest products.
It is a good idea to digest control samples of known genotype on the same gel
both to assist in assessing unknown genotypes and to be sure that the restriction
reaction has actually worked. Depending on the PCR primers used, the drges-
tion products from the Vall16 and from His,s4 alleles could be very stmtlar m
size, and it 1s sometimes necessary to use two controls: one Val/Val,36 and the
other encoding HisiS4. The use of a sheep of genotype Val/Ala,s6 Arg/His,54
will work well for some sizes of fragments, but not all.

2.3. Detection of Variants at Codon 771
For routine analysis, one PCR reaction can be split mto two-one-half for
codon 136 and 154 analysis and the other for codon 17 1 analysis. It is possible
to divide one PCR reaction product even further and to carry out addttronal
analyses with care.
Codon 171 variants cannot be detected by restriction analysis, but one
method that has been used successfully 1s that of allele-specific differential
hybridization. This can be carried out using dot-blots or slot-blots of the PCR
product Itself (15). Taking the time to run the product on a 1% TBE gel and
217
Sheep PrP Gene and Scrap/e
carrying out standard Southern analysis is worthwhile because every individual
DNA does not produce the same amount of PCR product and there are times
when it JS really necessary to see how well the PCR has worked.

<<

. 31
( 45 .)



>>